Skip to main content

Table 1 Design of LAMP primers for detection of the E198K/A/V mutations of TUB2 in Botrytis cinerea

From: Rapid detection of benzimidazole resistance in Botrytis cinerea by loop-mediated isothermal amplification

Primer Type Length (bp) Sequence (5′-3′)
F3 Forward outer 21 GCAACTCTCTCTGTCCATCAA
B3 Backward outer 21 CCAACTTTCGGAGATCTGAGT
BIP Backward inner(B1c-B2) 42 TCTTAACCACTTGGTTTCCGCCGAAGTTGACCAGGGAAACGG
Tub-E198V Forward inner(F1c-F2) 47 GGTTGCTGAGCTTCAAGGTTCTCACAATTGGTTGAGAACTCTGAGbGTa
Tub-E198A Forward inner(F1c-F2) 47 GGTTGCTGAGCTTCAAGGTTCTCACAATTGGTTGAGAACTCTGATbGCa
Tub-E198K Forward inner(F1c-F2) 46 GGTTGCTGAGCTTCAAGGTTCTCACAATTGGTTGAGAACTCTGTbCAa
  1. aNecleotides in bold are modified from the sequence of the TUB2 gene in the sensitive and the resistant isolates
  2. bNecleotides underlined are mismatches introduced specifically to distinguish B.cinerea genotypes (E198K/A/V)