Skip to main content

Table 3 Primers used in this study to amplify BcOs1 and BctubA gene fragments

From: Fungicide resistance of Botrytis cinerea from strawberry to procymidone and zoxamide in Hubei, China

Primer Sequence (5′-3′) Location in gene Reference
Bc-f (forward)
Bc-r (reverse)
CAGGAAACACTTTTGGGGATA
GAGGGACAAGAAAATCGACTAA
Amplify 327 bp BcOs1 gene fragment of B. cinerea (Fan et al. 2015)
BF1 (forward)
BR1 (reverse)
TACCGATCGAAAAACCCAAC
TGGGCTGGTCTCTCAATCTT
Amplify 990 bp (95–1085) BcOs1 gene fragment of B. cinerea (Ma et al. 2007)
BF2 (forward)
BR2 (reverse)
CAACGTTATGGCACAAAATCTCA
AAGTTTCTGGCCATGGTGTTCA
Amplify 848 bp (981–1829) BcOs1 gene fragment of B. cinerea
P1 (forward)
P2 (reverse)
ATGCGTGAGATTGTATGTATTTC
CTATTCCTCGCCCTCAATTG
Amplify 1765 bp β-tubulin gene fragment of B. cinerea (Liu et al. 2010)
Bc365PM (forward)
Bc365PM (reverse)
GAAAGCGAAGGCGTCCAG
GTCTCCCTTTGCGACAGC
Allele specific PCR primers to detect
I365S point mutation in BcOs1 gene
This study