Table 3 Primers used in this study to amplify BcOs1 and BctubA gene fragments
From: Fungicide resistance of Botrytis cinerea from strawberry to procymidone and zoxamide in Hubei, China
Primer | Sequence (5′-3′) | Location in gene | Reference |
|---|---|---|---|
Bc-f (forward) Bc-r (reverse) | CAGGAAACACTTTTGGGGATA GAGGGACAAGAAAATCGACTAA | Amplify 327 bp BcOs1 gene fragment of B. cinerea | (Fan et al. 2015) |
BF1 (forward) BR1 (reverse) | TACCGATCGAAAAACCCAAC TGGGCTGGTCTCTCAATCTT | Amplify 990 bp (95–1085) BcOs1 gene fragment of B. cinerea | (Ma et al. 2007) |
BF2 (forward) BR2 (reverse) | CAACGTTATGGCACAAAATCTCA AAGTTTCTGGCCATGGTGTTCA | Amplify 848 bp (981–1829) BcOs1 gene fragment of B. cinerea | |
P1 (forward) P2 (reverse) | ATGCGTGAGATTGTATGTATTTC CTATTCCTCGCCCTCAATTG | Amplify 1765 bp β-tubulin gene fragment of B. cinerea | (Liu et al. 2010) |
Bc365PM (forward) Bc365PM (reverse) | GAAAGCGAAGGCGTCCAG GTCTCCCTTTGCGACAGC | Allele specific PCR primers to detect I365S point mutation in BcOs1 gene | This study |