Skip to main content

Table 6 Nucleotide sequences used to predict functional binding sites in non-coding region upstream of CYP51 in Ustilaginoidea virens

From: Monitoring and analysis of rice pathogen Ustilaginoidea virens isolates with resistance to sterol demethylation inhibitors in China

Name

Nucleotide sequences

sequence A

gatctcgccttttgctcatcagcccaggcggagaggggaaccaagtcgaattgtataaatctggcagcggccgtcattcttctcgagccgaat

sequence B

gatctcgccttttgctcatcagcccCCaggcggagaggggaaccaagtcgaattgtataaatctggcagcggccgtcattcttctcgagccgaat

  1. The nucleotide sequence in bold font is the predicted promoter region, and the uppercase letters indicate the insertion mutation in propiconazole-resistant isolates
Back to article page

Phytopathology Research

ISSN: 2524-4167