Characterization of mating type, spore killing, and pathogenicity of Fusarium verticillioides populations from maize in China

Table 2 Primer sequences used in this study

Name	Sequence (5′–3′)	Purpose
EF-1 F	ATGGGTAAGGARGACAAGAC	Primer pair for the identification of F.verticillioides
EF-1 R	GGARGTACCAGTSATCATGTT	Primer pair for the identification of F.verticillioides
GFmat1a	GTTCATCAAAGGGCAAGCG	Primer pair for the identification of the mating type
GFmat1b	TAAGCGCCCTCTTAACGCCTTC	Primer pair for the identification of the mating type
GFmat2c	AGCGTCATTATTCGATCAAG	Primer pair for the identification of the mating type
GFmat2d	CTACGTTGAGAGCTGTACAG	Primer pair for the identification of the mating type
SkF	CGAATGACCTGGGGAGCCATAA	Primer pair for the identification of the spore killing genotype
SkR	TCTCTCCACCACCTCCATCAGC
Maize_EF-1α_F	TGGGCCTACTGGTCTTACTACTGA	Primer pair for detection of relative biomass in maize kernels
Maize_EF-1α_R	ACATACCCACGCTTCAGATCCT
Fv_Tub_F	CCCCGAGGACTTACGATGTC	Primer pair for detection of relative biomass of F. verticillioides in maize kernels
Fv_Tub_R	CGCTTGAAGAGCTCCTGGAT