Synthetic modulation of ROS scavenging during host—Sclerotinia sclerotiorum interaction: a new strategy for the development of highly resistant plants

Abstract

Sclerotinia sclerotiorum is a widespread fungal pathogen responsible for significant crop losses across the globe. The challenge of breeding resistant varieties is exacerbated by the fungus's sophisticated pathogenic mechanisms. A pivotal factor in the host-pathogen interaction is the regulation of reactive oxygen species (ROS) within both the fungi and the host plants. However, there is currently no efficient strategy to leverage this interaction mechanism for developing disease-resistant crop varieties. Here, we introduce an engineered ROS scavenging system designated as syn-ROS for impairing ROS neutralization in S. sclerotiorum while concurrently fortifying it in the host. The syn-ROS system comprises gene silencing constructs targeting the S. sclerotiorum Cu/Zn superoxide dismutase (SsSOD) and its copper chaperone (SsCCS), alongside overexpression constructs for the Arabidopsis thaliana AtSOD1 and AtCCS. Transgenic plants carrying the syn-ROS system demonstrated a marked enhancement in resistance to S. sclerotiorum. Upon infection, the expression of SsSOD and SsCCS was reduced, while the expression of AtSOD1 and AtCCS was enhanced in syn-ROS transgenic plants. Moreover, the infected syn-ROS plants showed decreased Cu/Zn SOD enzyme activity and elevated ROS concentrations within the fungal cells. In contrast, the cells of A. thaliana manifested increased Cu/Zn SOD enzyme activity and lowered ROS levels. Collectively, these findings suggest a novel and promising approach for contriving plants with robust resistance by synthetically manipulating ROS scavenging activities in the interaction between the host and S. sclerotiorum.

Background

Sclerotinia sclerotiorum is a phytopathogen with a broad host range, inflicting significant damage to vital food crops (Bolton et al. 2006; Liang and Rollins 2018). The ability of this pathogen to produce durable sclerotia complicates its management and underscores the intricacy of its pathogenic mechanisms (Zhu et al. 2013). Despite numerous attempts to mitigate its impact, the existing control strategies for S. sclerotiorum fall short, highlighting the imperative to devise innovative management approaches that effectively curb its damage. An in-depth comprehension of the interaction between the host plants and S. sclerotiorum could pave the way for developing novel control methods to combat Sclerotinia stem rot.

S. sclerotiorum secretes an arsenal of plant cell wall-degrading enzymes (PCWDEs), cutinase, proteases, and oxalic acid (OA), along with various effectors to facilitate the destruction of host cells and enable the pathogen to manipulate the host's cellular processes (Williams et al. 2011; Liang and Rollins 2018). In a defensive countermeasure, plants have evolved a sophisticated two-layered immune surveillance system to thwart pathogenic attacks (Jones and Dangl 2006). Pattern recognition receptors (PRRs) at the cell surface detect conserved pathogen-associated molecular patterns (PAMPs), thereby initiating PAMP-triggered immunity (PTI). Pathogens deploy effectors to subvert this frontline defense, activating effector-triggered immunity (ETI). The defenses mounted by PTI and ETI share common downstream immune responses, orchestrating a comprehensive protective strategy (Boller and Felix 2009). Recent findings underscore the importance of a prompt and initial plant defense involving the transient generation of reactive oxygen species (ROS), a crucial aspect of PTI and ETI (Yuan et al. 2021). Contemporary studies also illustrate the pivotal role of modulating ROS accumulation during host-pathogen interactions (Singh et al. 2021). S. sclerotiorum is known to finely tune the host's redox environment, dampening the oxidative burst during the early stages of infection to benefit its proliferation while inducing ROS levels in the late stages of infection to promote apoptotic cell death and facilitate disease progression (Williams et al. 2011; Kabbage et al. 2013).

ROS, such as singlet oxygen, superoxide anion (·O²⁻), hydrogen peroxide (H₂O₂), and hydroxyl anion, play a pivotal role in directly neutralizing pathogens and blocking their incursions (Mittler 2017). Moreover, ROS serve as signaling molecules that prompt the activation of defense gene expression and initiate immune responses in plants (Mittler et al. 2011; Waszczak et al. 2018). To overcome the ROS onslaught from the host and ensure successful colonization, fungal phytopathogens have developed sophisticated ROS scavenging strategies to shield themselves from ROS-induced damage (Singh et al. 2021). The ROS defense apparatus within fungi has been thoroughly investigated (Segal and Wilson 2018). A suite of antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT), peroxidases (POD), thioredoxins (Trx), and glutaredoxins (GSH), along with a variety of non-enzymatic antioxidants, is central to the intracellular detoxification of ROS (Shao et al. 2020). SOD acts as the chief converter of superoxide radicals, mitigating the hazardous excess of ROS (Mittler 2017). Experimental evidence in the phytopathogenic fungus S. sclerotiorum reveals that suppressing SsSOD expression correlates with reduced fungal aggressiveness (Veluchamy et al. 2012; Xu and Chen 2013). Our prior research indicated that S. sclerotiorum enhances the copper chaperone gene SsCCS expression to activate SsSOD, a crucial step for the fungus to counteract high ROS levels during infection and maintain viability (Ding et al. 2020). Similarly, the induction of CCS (copper chaperone for SOD) in resistant host plants is instrumental in preserving the antioxidative function of SOD, thus mitigating excess ROS (Ding et al. 2020).

In the current study, we engineered a novel synthetic ROS scavenging system by introducing RNA interference (RNAi) constructs targeting the S. sclerotiorum genes SsSOD and SsCCS, as well as overexpression vectors for the A. thaliana genes AtSOD1 and AtCCS. Our results demonstrate that plants equipped with this synthetic system showed enhanced resistance against S. sclerotiorum. Through comprehensive analysis, we concluded that the observed increase in resistance was principally due to the dual effect of impaired ROS detoxification in S. sclerotiorum and augmented ROS scavenging capacity in A. thaliana during the course of infection.

Results

A synthetic ROS scavenging system was designed and successfully established in A. thaliana

Our previous research elucidated the role of SOD and CCS in the modulation of ROS in both the fungus and host plants during S. sclerotiorum infection (Ding et al. 2020). In this present study, SOD and CCS genes from A. thaliana and S. sclerotiorum were selected to construct the synthetic ROS scavenging system. Expression analysis indicated a significant elevation in the expression levels of SsSOD and SsCCS amidst infection (Additional file 1: Figure S1). Among the three SOD homolog genes in A. thaliana, AtSOD1 showed the highest expression level during S. sclerotiorum infection (Additional file 1: Figure S1). Concurrently, an infection-induced upsurge was observed for AtCCS (Additional file 1: Figure S1). Phylogenetic tree analyses confirmed the distinctiveness of SsCCS and SsSOD from plant CCS and SODs, respectively (Additional file 1: Figure S2). Multiple sequence alignment showed that the target RNAi sequence of SsSOD revealed 17.43% similarity with AtSOD1, and the target RNAi sequence of SsCCS revealed 7.17% similarity with AtCCS (Additional file 1: Figure S3). Specific sequences of SsSOD and SsCCS were used to construct single-target Host-induced Gene Silencing (HIGS) binaries (SsSOD-HIGS and SsCCS-HIGS) and a double-target HIGS binary (SsCCS-SsSOD-HIGS) (Fig. 1a). To enhance ROS detoxification in A. thaliana during infection, single (AtCCS-OE and AtSOD1-OE) and double-target (AtCCS-AtSOD1-OE) overexpression binaries for AtCCS and AtSOD1 were constructed (Ding et al. 2020, Fig. 1a). The synthetic ROS scavenging system (syn-ROS: SsCCS-SsSOD-HIGS + AtCCS-AtSOD1-OE) was engineered by fusing SsCCS-SsSOD-HIGS with AtCCS-AtSOD1-OE, aiming to preemptively mitigate the ROS neutralizing capacity in S. sclerotiorum while concurrently reinforcing it within A. thaliana during the infection process (Fig. 1a).

Fig. 1

Identification and verification of transgenic A. thaliana plants carrying the reactive oxygen species (ROS) scavenging system binary vectors. a Schematic representation of the binary vectors used for molecular design of ROS scavenging. b Relative expression levels of specific siRNA targets for SsCCS and SsSOD in transgenic A. thaliana plants. The expression levels were quantified by normalizing the quantity of A. thaliana AtU6-26 cDNA in different samples. c Relative expression levels of AtCCS and AtSOD1 in transgenic A. thaliana plants. The expression levels were quantified by normalizing the quantity of A. thaliana AtActin7 and AtActin2 cDNA in different samples. Data are presented as means ± SEM (n = 3, technical replicates). Asterisks indicate a statistically significant difference with the control line (CK) at p < 0.05 (two-sided Student's t-test). The relative expression of target siRNA or gene in CK was set as one, respectively. CK: A. thaliana plants carrying the empty vector

All the binary vectors were transformed into wild-type A. thaliana Col-0. The T₃ generation transgenic seedlings showed no noticeable difference in growth compared to control plants carrying the empty vector (Additional file 1: Figure S4). To confirm the efficiency of HIGS, stem-loop qRT-PCR was conducted to measure the production of specific siRNAs for SsCCS (SsCCS-siRNA) and SsSOD (SsSOD-siRNA). The results revealed high expression of SsCCS-siRNA in SsCCS-HIGS, SsCCS-SsSOD-HIGS, and syn-ROS lines, while SsSOD-siRNA was highly expressed in SsSOD-HIGS, SsCCS-SsSOD-HIGS, and syn-ROS lines (Fig. 1b). No expression of SsCCS-siRNA and SsSOD-siRNA was detected in control plant (Fig. 1b). To investigate the expression of the host genes, qRT-PCR analysis, normalized to the reference genes AtActin7 and AtActin2, revealed that the transcript levels of AtCCS in AtCCS-OE, AtCCS-AtSOD1-OE, and syn-ROS lines experienced an average increase of 6.5-fold, 4.9-fold, and 3.9-fold, respectively, compared to the controls (Fig. 1c). Similarly, transcript abundance of AtSOD1 in AtSOD1-OE, AtCCS-AtSOD1-OE, and syn-ROS lines was averagely escalated to 8.3-fold, 6.4-fold, and 3.6-fold above control levels, respectively (Fig. 1c). Furthermore, we analyzed the gene expression of AtCCS and AtSOD1 in HIGS lines, and no significant difference was detected among CK (control line) and HIGS lines (Additional file 1: Figure S5).

Enhanced S. sclerotiorum resistance was observed in plants harboring the synthetic ROS scavenging system

To evaluate the effectiveness of the synthetic ROS scavenging system in protecting transgenic A. thaliana plants from S. sclerotiorum infection, resistance was assessed using both in vitro (detached leaf) and in vivo (intact leaf) assays. The results revealed that the lesion sizes on the infected transgenic lines were notably smaller than those on the control line at 24 hpi (hours post-inoculation) (Fig. 2a, b). In the in vitro assay, the average lesion size on the control line was 1.00 cm². The lesions were significantly reduced by approximately 46.48% to 73.00% on the transgenic lines, specifically SsCCS-HIGS (0.54 cm²), SsSOD-HIGS (0.41 cm²), SsCCS-SsSOD-HIGS (0.38 cm²), AtCCS-OE (0.51 cm²), AtSOD1-OE (0.41 cm²), AtCCS-AtSOD1-OE (0.33 cm²), and syn-ROS line (0.27 cm²) (Fig. 2c). Additionally, compared to the lines harboring single or dual gene constructs (SsCCS-HIGS, SsSOD-HIGS, SsCCS-SsSOD-HIGS, AtCCS-OE, AtSOD1-OE, and AtCCS-AtSOD1-OE), the lesion sizes on the syn-ROS line displayed further reductions for 49.56%, 33.52%, 22.33%, 47.57%, 34.53%, and 17.67%, respectively (Fig. 2c). Similar results were recorded in the in vivo assay. On the intact leaves, the syn-ROS line showed a striking reduction in lesion size of approximately 70.24% (0.24 cm²), compared to the control line (0.95 cm²) (Fig. 2d). Moreover, when contrasted with the lines carrying single or dual gene constructs, the lesions on the syn-ROS line were decreased by 53.98%, 39.19%, 35.13%, 50.90%, 38.94%, and 26.17% for SsCCS-HIGS, SsSOD-HIGS, SsCCS-SsSOD-HIGS, AtCCS-OE, AtSOD1-OE, and AtCCS-AtSOD1-OE, respectively (Fig. 2d). These findings highlight the potential benefits of employing synthetic ROS scavenging systems for enhancing resistance to S. sclerotiorum in A. thaliana.

Fig. 2

Lesion areas of transgenic A. thaliana plants infected with Sclerotinia sclerotiorum at 24 h post-inoculation (hpi). a and b Disease symptoms of transgenic A. thaliana plants at 24 hpi with S. sclerotiorum wild-type strain 1980 in vitro and in vivo. c and d Quantification of lesion areas at 24 hpi in vitro and in vivo. Data are presented as means ± SEM (n > 15 plants). Different letters indicate significant difference at p < 0.05 (one-way ANOVA followed by Tukey’s post hoc test). CK: A. thaliana plants carrying the empty vector

The expression levels of target genes during S. sclerotiorum infection in transgenic A. thaliana were quantified at 12 and 24 hpi utilizing the qRT-PCR assay. Notable reductions in the relative gene expression of SsCCS and SsSOD were detected in the transgenic lines SsCCS-HIGS, SsSOD-HIGS, SsCCS-SsSOD-HIGS, and syn-ROS lines in comparison to the control line (Fig. 3a, b). After normalizing with two internal housekeeping genes (SsTubullin and SsActin), the transcript levels of SsCCS exhibited a mean down-regulation of roughly 61%, 50%, and 29% in the SsCCS-HIGS, SsCCS-SsSOD-HIGS, and syn-ROS lines at 12 hpi, respectively (Fig. 3a). At 24 hpi, this down-regulation increased to about 64%, 60%, and 58%, respectively (Fig. 3a). Similarly, down-regulation was observed for SsSOD in the SsSOD-HIGS, SsCCS-SsSOD-HIGS, and syn-ROS lines (Fig. 3b), where the average transcript levels showed a decrease in expression by approximately 43% for both the SsSOD-HIGS and SsCCS-SsSOD-HIGS, and 37% for the syn-ROS lines at 12 hpi, with a more pronounced reduction of 67%, 68%, and 68% at 24 hpi, respectively (Fig. 3b). Conversely, the relative expression of AtCCS and AtSOD1 displayed an upward trend during the infection in the AtCCS-OE, AtSOD1-OE, AtCCS-AtSOD1-OE, and syn-ROS lines when compared to the control line (Fig. 3c, d). After normalization with two internal reference genes (AtActin7 and AtActin2), the transcript levels of AtCCS were, on average, approximately 5.4-fold, 5.0-fold, and 3.9-fold higher in the AtCCS-OE, AtCCS-AtSOD1-OE, and syn-ROS lines at 12 hpi, respectively (Fig. 3c). This elevation in gene expression persisted at 24 hpi, where it rose to about 6.0-fold, 4.7-fold, and 4.4-fold, respectively (Fig. 3c). Similarly, the average transcript levels of AtSOD1 revealed a surge in expression by roughly 7.7-fold, 5.2-fold, and 4.0-fold at 12 hpi, and by 4.8-fold, 4.3-fold, and 3.2-fold at 24 hpi in the AtSOD1-OE, AtCCS-AtSOD1-OE, and syn-ROS lines, respectively (Fig. 3d). These findings elucidate that the synthetic ROS scavenging system in A. thaliana effectively attenuates the expression of pathogenic genes SsCCS and SsSOD while concurrently amplifying the plant AtCCS and AtSOD1, during an encounter with S. sclerotiorum, thus impeding the expansion of S. sclerotiorum.

Fig. 3

Gene expression analysis in transgenic A. thaliana plants during infection. a–d Relative expression levels of SsCCS, SsSOD, AtCCS, and AtSOD1 in transgenic A. thaliana plants at 12 hpi and 24 hpi. The expression levels were quantified by normalizing the quantity of S. sclerotiorum Sstubulin and SsActin cDNA for SsCCS and SsSOD, and A. thaliana AtActin7 and AtActin2 cDNA for AtCCS and AtSOD1 in different samples. Data are presented as means ± SEM (n = 3, technical replicates). Different letters indicate significant difference at p < 0.05 (one-way ANOVA followed by Tukey’s post hoc test). The relative expression of the target gene in CK at 12 hpi was set as one, respectively. CK: A. thaliana plants carrying the empty vector

ROS accumulation in S. sclerotiorum cells and A. thaliana cells

To investigate the functionality of the synthetic ROS scavenging system further, we assessed ROS accumulation and Cu/Zn SOD enzyme activity in S. sclerotiorum-infected transgenic A. thaliana lines during infection. ROS accumulation was determined using DAB (3,3′-diaminobenzidine) and NBT (Nitroblue tetrazolium chloride) staining at 24 hpi. The results indicated pronounced staining in the control line, indicative of higher ROS levels, while the syn-ROS line displayed markedly less staining (Fig. 4a). This observation was substantiated by quantifying H₂O₂ and·O²⁻ levels, with the infected syn-ROS line demonstrating lower H₂O₂ and ·O²⁻ content relative to the control line (Fig. 4b, c). Furthermore, an elevated ·O²⁻ level was noted in the lesion area of the SsCCS-SsSOD-HIGS line compared to the control, hinting at an impaired ROS scavenging capability in S. sclerotiorum (Fig. 4a, c).

Fig. 4

Reactive oxygen species (ROS) accumulation in infected transgenic A. thaliana plants. a 3,3'-diaminobenzidine (DAB, indicating H₂O₂ accumulation) and nitroblue tetrazolium (NBT, indicating superoxide anion [·O²⁻] accumulation) staining at 24 hpi. One representative replicate from the three independent experiments is shown. Three leaves were stained in each experiment. b and c Quantification of H₂O₂ accumulation and ·O²⁻ accumulation in the infected tissue (necrotic tissue including the tissue 0.5 cm around the lesion edge) of transgenic A. thaliana plants. Data are presented as means ± SEM (n = 6, independent experiments). d Relative expression level of AtPRXIIB in syn-ROS and control lines at 24 hpi by normalizing with the quantity of A. thaliana AtActin7 and AtActin2 cDNA. Data are presented as means ± SEM (n = 3, technical replicates). The relative expression of the target gene in CK was set as one. e Relative expression level of SsGpx3 in syn-ROS and control lines at 24 hpi by normalizing with the quantity of S. sclerotiorum Sstubulin and SsActin cDNA. Data are presented as means ± SEM (n = 3, technical replicates). The relative expression of the target gene in CK was set as one. f ROS accumulation in A. thaliana protoplasts of infected syn-ROS and control lines at 24 hpi as detected by the fluorescent probe 2',7'-dichlorofluorescein diacetate (H₂DCFDA). Scale bars = 20 μm. g ROS accumulation in S. sclerotiorum protoplasts of infected syn-ROS at 24 hpi as detected by the fluorescent probe H₂DCFDA. Scale bars = 5 μm. h Quantification of relative fluorescent intensity in f and g. Data are presented as means ± SEM (n = 3, independent experiments). The fluorescent images of the protoplasts were captured using a confocal microscope. Different letters and asterisks indicate significant difference at p < 0.05 (b and c, one-way ANOVA followed by Tukey’s post hoc test; d–h, two-sided Student’s t-test). CK: A. thaliana plants carrying the empty vector

To monitor the dynamic ROS levels in A. thaliana and S. sclerotiorum cells, we analyzed the gene expression of cytosolic thiol peroxidase, a known intracellular sensor for ROS (Delaunay et al. 2002; Bi et al. 2022), from A. thaliana (AtPRXIIB) and S. sclerotiorum (SsGpx3). Our findings revealed a down-regulation of AtPRXIIB expression in the syn-ROS line (Fig. 4d). Conversely, SsGpx3 expression was up-regulated in the syn-ROS line in comparison to the control (Fig. 4e) at 24 hpi. Furthermore, after isolating cells from the infected tissue at the same time point, we assessed the ROS levels in both S. sclerotiorum and A. thaliana cells using H₂DCFDA (2',7'-dichlorodihydrofluorescein diacetate) staining (Fig. 4f, g). In comparison with those of the control line, fluorescence microscopy analyses showed a decrease in ROS levels in A. thaliana cells of the syn-ROS line (Fig. 4f, h), whereas S. sclerotiorum cells of the syn-ROS line exhibited an increase (Fig. 4g, h). These findings align with the Cu/Zn SOD enzyme activity results, where a significantly lower activity was detected in S. sclerotiorum cells, and a higher activity was observed in A. thaliana cells from the infected syn-ROS line compared to the control line (Fig. 5).

Fig. 5

Copper/zinc superoxide dismutase (Cu/Zn SOD) enzyme activity in S. sclerotiorum cells and A. thaliana cells. Data are presented as means ± SEM (n = 3, independent experiments). Asterisks indicate a statistically significant difference at p < 0.05 (two-sided Student’s t-test). CK: A. thaliana plants carrying the empty vector

In summary, the data suggest that the syn-ROS system augments ROS detoxification within the host plant while concurrently inhibiting fungal ROS detoxification mechanisms. This imbalance restricts the ability of S. sclerotiorum to adapt to the host's hyperoxic conditions and leads to a decrease in the pathogen's virulence in transgenic plants.

Discussion

The growing prevalence of fungicide resistance compounds the escalating threat of fungal phytopathogens to global crop yields. Tackling this issue necessitates an in-depth understanding of the mechanisms by which crop plants resist fungal infections and the strategies fungi employ to colonize their hosts. These insights are essential for developing crops with broad-spectrum disease resistance (Zhao et al. 2022). In our study, we engineered a molecular synthetic pathway aimed at bolstering the plant's defensive mechanisms while concurrently inhibiting fungal pathogenic processes. We specifically targeted the ROS scavenging pathway to test the effectiveness of our design against S. sclerotiorum. The engineered transgenic A. thaliana with the synthetic ROS scavenging system displayed significantly increased resistance to S. sclerotiorum, underscoring the potential of our approach. These results enhance our comprehension of plant-pathogen interaction and offer practical applications for the management of crop diseases.

Traditionally, the overexpression of resistance genes has proven to be a successful strategy against S. sclerotiorum in a variety of crops. Resistance has been achieved by overexpressing genes, such as BnaMPK3, BnaMPK6, BnPGIPs, and various others in crops like Brassica napus, and introducing genes from different species, such as barley oxalate oxidase OXO into Brassica juncea and lettuce, as well as the leveraging of different resistance genes in soybean and tobacco (Yang et al. 2019; Wang et al. 2019, 2020a, b; Liu et al. 2021; Peng et al. 2021; Verma and Kaur 2021; Wang et al. 2021; Zhang et al. 2021). Additionally, deploying HIGS, a technique utilizing RNA interference to target pathogens, has provided a novel method of conferring resistance in a range of host plants (Andrade et al. 2015; Ding et al. 2021; McCaghey et al. 2021; Maximiano et al. 2022; Rana et al. 2022; Wu et al. 2022). Our study has taken these efforts further by creating a genetic construct that simultaneously produces siRNAs aimed at suppressing the SsSOD and SsCCS genes of the pathogen and upregulating the expression of the plant's own AtSOD1 and AtCCS genes. Transgenic A. thaliana lines harboring this construct (termed syn-ROS) demonstrated a substantial increase in resistance to S. sclerotiorum compared to control lines, with the syn-ROS line showing a marked twofold increase in resistance over those containing individual or dual-gene constructs. This signifies the success of our tailored molecular synthetic pathway in enhancing resistance to S. sclerotiorum.

The overabundance of ROS, often referred to as the oxidative burst, constitutes a pivotal component of the host-pathogen interaction. Upregulation of ROS-scavenging genes within the host has been associated with a bolstered defense against fungal infections instigated by a range of pathogens, including Fusarium graminearum, Botrytis cinerea, Aspergillus niger, and S. sclerotiorum (Koubaa and Brini 2020; Chai et al. 2022). Conversely, genetic deletion of SOD or catalase in various phytopathogens such as Verticillium dahliae, B. cinerea, F. graminearum, and S. sclerotiorum, elicits marked attenuation in lesion progression, host colonization efficiency, and pathogenic virulence (Veluchamy et al. 2012; Xu and Chen 2013; López-Cruz et al. 2017; Yao et al. 2016; Tian et al. 2021). This body of evidence suggests that strategic modulation of ROS scavenging enzymatic activity in both plant hosts and pathogens can converge upon a unified resistance phenotype in plants. Cu/Zn SOD, a metalloenzyme, is rendered active by copper ions that are translocated by the copper chaperone for SOD (CCS) (Banci et al. 2012). In our study, we observed a downregulation of SsSOD and SsCCS expression in the infected syn-ROS line, culminating in elevated ROS levels and diminished Cu/Zn SOD enzymatic activity within S. sclerotiorum cells. The transcript level of AtSOD1 and AtCCS was increased in the syn-ROS lines, leading to a mitigation of ROS accumulation and an amplification of Cu/Zn SOD enzyme action. Our findings underscore the crucial significance of ROS equilibrium in governing host-pathogen interaction and intimate that targeted synthetic modulation of ROS levels could be harnessed in crop breeding strategies to maximize disease resistance.

ROS are pivotal signaling molecules that orchestrate a variety of vital biological functions, including the regulation of cellular proliferation and differentiation (Mittler 2017). In our investigation, we leveraged a synthetic ROS modulation pathway under the control of the CaMV 35S promoter, which facilitates constitutive and spatially variable expression across different tissues in transgenic lines (Kiselev et al. 2021). Despite these modifications, the transgenic seedlings of the T₃ generation did not display noticeable growth discrepancies when contrasted with control plants. One potential rationale for this observation lies in the capacity of SODs to transform radical species, such as superoxide and hydroxyl radicals, into molecular oxygen and H₂O₂. Subsequently, H₂O₂ is detoxified into H₂O and dioxygen by catalases and peroxidases (Mittler et al. 2011). These antioxidant defenses are pivotal in preserving ROS at baseline concentrations under normal physiological states in plants (El Hadrami et al. 2005). Moreover, the more pronounced signaling role of H₂O₂ as a principal secondary messenger may also explain the observed growth patterns (Sies et al. 2017). The balance between plant defense and growth presents a formidable challenge in current botanical research. Initiatives have been undertaken to uncover "molecular switch" promoters capable of activating the immune system exclusively upon pathogen assault, thus preventing activation under regular growth conditions, which could compromise plant development (Xu et al. 2017). Recent advancements identified an inducible promoter triggered by S. sclerotiorum that diminishes the inappropriate expression of defense genes (Lin et al. 2022). The application of such tailored "molecular switch" promoters may refine the construction of the synthetic molecular pathways examined in our analysis.

The insightful biological knowledge derived from fundamental research is poised to be translated into practical advancements in plant breeding, as evidenced by recent studies (Yan and Wang 2023). The advent of molecular design breeding represents a sophisticated and precise method for crop enhancement that has become increasingly important in contemporary agriculture (Shen et al. 2019; Wang et al. 2020a, b). The methodology formulated in this investigation can be adapted to the molecular design of additional pathways beyond the regulation of ROS. Recent years have witnessed significant breakthroughs in comprehending the intricate interactions between host plants and the fungus S. sclerotiorum. A cadre of secreted proteins, such as SsSSVP1, SsCP1, SsITL, and SsPINE1, have been identified in directly interacting with host proteins to manipulate plant resistance pathways and, consequently, in heightening fungal virulence (Lyu et al. 2016; Yang et al. 2018; Tang et al. 2020; Wei et al. 2022). Deciphering the mechanisms of these interactions can facilitate the creation of S. sclerotiorum-resistant cultivars employing the strategy elucidated in our study.

Conclusions

This research introduces an innovative approach for combatting fungal pathogens, exemplifying a molecular synthetic pathway that modulates ROS detoxification. It underscores the burgeoning potential of employing targeted molecular design in precision breeding tactics.

Methods

Culture conditions for plants and fungal strains

The wild-type strain of A. thaliana, known as Col-0 (Columbia-0), was grown under long-day conditions, featuring a cycle of 16 h of light followed by 8 h of darkness in controlled-environment growth chambers set to 20°C. The wild-type strain of S. sclerotiorum, strain 1980, was regularly cultured and preserved on potato dextrose agar (PDA) plates, consisting of 20% potato, 2% dextrose, and 1.5% agar, at a temperature of 22°C.

Binary constructs and plant transformation

A 364 bp DNA fragment encoding SsSOD was utilized to construct the host-induced SsSOD silencing vector. The sense and antisense fragments were amplified using the primer pairs SsSOD-SF/SR and SsSOD-AF/AR, respectively (Additional file 2: Table S1). Similarly, to craft the host-induced SsCCS silencing vector, a 316 bp DNA fragment of SsCCS was used, with its sense and antisense sequences amplified using the primer pairs SsCCS-SF/SR and SsCCS-AF/AR, respectively (Additional file 2: Table S1). These sense and antisense sequences were subsequently linked in-frame to the 5' and 3' termini of an amiRNA stem-loop structure. These RNAi-based elements were cloned downstream of the 35S promoter in a vector marked with red fluorescence, yielding the RNAi-based host-induced gene silencing (HIGS) constructs SsCCS-HIGS and SsSOD-HIGS. To assemble the combined SsCCS-SsSOD-HIGS construct, the RNAi cassette for SsCCS (comprising sequence and antisense fragments with an intervening intron) was joined to the SsSOD RNAi cassette through an efficient process of homologous recombination using the ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China).

To create AtCCS and AtSOD1 overexpression (OE) lines, the corresponding coding sequences for each gene were subcloned into a vector marked by red fluorescence and controlled by the 35S promoter. This resulted in the construction of the AtCCS-OE and AtSOD1-OE vectors. In assembling the dual overexpression construct AtCCS-AtSOD1-OE, the AtCCS overexpression cassette was fused with the AtSOD1 overexpression cassette via homologous recombination.

A synthetic ROS scavenging construct was generated by merging the SsCCS-SsSOD-HIGS with the AtCCS-AtSOD1-OE cassettes through homologous recombination. The transformation of A. thaliana Col-0 plants with this construct was performed using the floral dip method (Clough and Bent 1998).

RNA isolation and transcript level analysis

Total RNA was extracted from the leaves of A. thaliana infected with the wild-type strain of S. sclerotiorum 1980 by employing the TRIzol method (Invitrogen, Carlsbad, CA). The extracted total RNA was then used to synthesize first-strand cDNA using the Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate Biotechnology Co, Hunan, China), following the manufacturer’s instructions. Quantitative RT-PCR analyses were conducted on the Bio-Rad CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA). The expression levels of S. sclerotiorum genes were analyzed using SsTubulin and SsActin as the internal controls, while expression levels for A. thaliana genes were determined using AtActin7 and AtActin2 for normalization. The real-time RT-PCR reactions utilized QuantiTect SYBR Green PCR Master Mix (Bio-Rad, USA), as specified by the manufacturer. The amplification program consisted of an initial cycle at 95 °C for 30 s, followed by 39 cycles at 95 °C for 5 s and 55–70 °C for 1 min. A melting curve analysis was then performed, ramping from 65 °C to 95 °C with a temperature increase of 0.5 °C every 5 s. Quantitative changes in gene expression were calculated using the 2^−ΔΔCT method (Livak and Schmittgen 2001). The analysis incorporated data from three biological replicates per sample and was facilitated by CFX Manager™ software (version 3.0). Details of the primers employed in the real-time RT-PCR are enumerated in Additional file 2: Table S1.

sRNA detection

To detect the production of SsCCS and SsSOD siRNAs in transgenic A. thaliana plants, stem-loop qRT-PCR was performed against the SsCCS and SsSOD genes of S. sclerotiorum, following the protocol of Mahto et al. (2020), with some modifications. For this purpose, the 316 bp sequence of SsCCS and the 364 bp sequence of SsSOD used for constructing the RNAi-based HIGS vectors were employed for siRNA detection using the BLOCK-iT™ RNAi Designer (http://rnaidesigner.thermofisher.com/). Putative siRNA sequences (SsCCS: AACUUCCUCUCUCCCUCAUGUUC; SsSOD: UAAUCUGACUAUCUUCAACGG) were identified and selected for stem-loop qRT-PCR. Low molecular weight RNA was isolated and used to synthesize cDNA using the stem-loop primer (ST-SsCCS and ST-SsSOD). Stem-loop qRT-PCR was performed using the Bio-Rad CFX96 Real-Time System (Bio-Rad, Hercules, CA, United States) and SYBR Green PCR master mix (Bio-Rad, USA), following the manufacturer’s instructions. The A. thaliana U6 gene (AtU6-26) was used as the internal reference to normalize the expression of siRNAs. The transcript levels of siRNAs were calculated from the threshold cycle using the 2^−ΔΔCT method (Livak and Schmittgen 2001) with three replicates, and the data were analyzed using CFX Manager™ v3.0. The primers used for performing stem-loop qRT-PCR are listed in Additional file 2: Table S1.

Resistance assay

To evaluate resistance levels, mycelial plugs measuring 0.2 cm in diameter were excised from the active growth edges of the wild-type S. sclerotiorum strain 1980. These plugs were then inoculated on the transgenic A. thaliana plants according to the previously described procedure (Ding et al. 2020). The extent of infection was quantified by measuring the lesion areas at 24 hpi. Each experimental replicate included a minimum of five leaves from each plant line, and the experiments were replicated three times.

ROS accumulation assay

The evaluation of ROS accumulation in transgenic A. thaliana leaves was conducted using DAB and NBT staining, following the protocol of Kumar et al. (2014). The A. thaliana leaves were infiltrated with a DAB solution (pH 3.8, Solarbio) or an NBT solution (Solarbio) under a mild vacuum for a duration of five hours. Subsequently, the staining solution was exchanged for a bleaching solution with a composition of ethanol: acetic acid: glycerol in a ratio of 3:1:1. After approximately 15 min in a boiling water bath (~ 90–95 °C), the bleaching solution was replaced with the fresh bleaching solution, and the leaves were stained in 60% glycerin. The level of H₂O₂ and ·O²⁻ in the infected tissue (necrotic tissue, including the tissue 0.5 cm around the lesion edge) of transgenic plants was quantified using the Hydrogen Peroxide (H₂O₂) content assay kit (BC3595; Solarbio) and Superoxide Anion activity content assay kit (BC1295; Solarbio), respectively, according to the manufacturer's protocol. The experiments were repeated six times.

To analyze the specific ROS scavenge ability in S. sclerotiorum and A. thaliana cells during infection, pure fungal and plant cells were isolated from infected A. thaliana tissue using the sequential protoplast purification method with modifications based on Cai et al. (2018). In brief, the infected A. thaliana tissue was rinsed with sterilized water to remove the hyphae on the surface of the leaves and then homogenized for one minute in isolation buffer (0.02 M MOPS buffer, pH 7.2, 0.2 M sucrose) using a blender on the highest speed setting to release S. sclerotiorum mycelium from host epidermal cells. The homogenate was filtered through a 70 µm nylon mesh to remove plant cell wall debris. The retained material on the filter was re-homogenized in an isolation buffer for 1 min and re-filtered. The resulting pellets were collected after centrifuging the pooled homogenate at 1500 g for 10 min, and then resuspended in 1% Triton X-100, washed three times with isolation buffer, and then incubated with plant cell wall digest solution (1.5% cellulose, 0.4% maceroenzyme, 0.4 M mannitol, 20 mM MES (pH 5.7), 20 mM KCl, 10 mM CaCl₂, and 0.1% BSA). After resuspension in 1% Triton X-100 and washing in isolation buffer five times to remove plant contents, the pellets were resuspended in lysing enzyme solution (2% lysing enzyme from Trichoderma harzianum (L3768, Sigma) and 0.2% snail enzyme from Helix pomatia (C8274, Sigma) in 0.8 M MgSO₄) and incubated at 28°C for 3–4 h to release fungal protoplasts. The fungal protoplasts were filtered through a 40 µm nylon mesh. A. thaliana cells were collected by digesting the retained plant material with plant cell wall digestion solution for 3 h at 25°C. The resulting plant protoplasts were filtered through a 70 μm nylon mesh.

Both purified fungal and plant cells were stained with H₂DCFDA (D6883, Sigma) to detect ROS contents. The fluorescent signal of H₂DCFDA staining reflects the ROS levels (Oparka et al. 2016). Samples were observed under a confocal microscope (LSM800/1080, Zeiss) with an excitation wavelength of 488 nm and an emission wavelength of 530 nm. To ensure consistency, the fluorescence intensity was compared across samples while maintaining uniform settings on the confocal microscope. Additionally, the enzyme activity of Cu/Zn superoxide dismutase (SOD) in the purified cells was determined using a Cu/Zn SOD assay kit (A001-4-1, Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's protocol. The experiments were repeated three times.

Statistical analysis

The experimental data accrued from the different biological replicates were analyzed using one-way analysis of variance (ANOVA). Subsequent statistical assessments were executed utilizing Prism 8 software (GraphPad Software, USA). The results were reported as the mean ± standard error of the mean (SEM). Differences achieving statistical significance when compared with the control were identified using a two-tailed Student's t-test, with * P < 0.05 denoting significance.